Journal: Photochemistry and photobiology

Article Title: PLK4 is a Potential Therapeutic Target in Nonmelanoma Skin Cancers: Evidence from Molecular and in vivo Studies

doi: 10.1111/php.70006

Figure Lengend Snippet: (a) Breakdown of tissue types and H&E images of the four tissue microarrays (TMAs) used for PLK4 expression analyses. (b) Vectra/InForm quantitation of PLK4 total expression in cutaneous squamous cell carcinomas (cSCC) and basal cell carcinomas (BCC) in comparison to normal & adjacent skin from the TMAs. (c) RT-qPCR analysis for PLK4 expression in (NHEK), cSCC cell line (A431) and BCC cell line (UW-BCC1); performed at least twice in triplicate, and statistical significance is relative to NHEK values. (d) NHEKs, A431, and UW-BCC1 were screened for PLK4 levels by ProteinSimple capillary western assay. PLK4 peak areas were normalized to the area of the capillary total protein assay, and each value was compared to the average of the three NHEK-normalized values. A rendered blot image is shown for reference. Data shown are presented as mean ± SEM with statistical significance **p ≤0.01; ***p≤0.001; ****p<0.0001.

Article Snippet: A431 PLK4 knockout cell pool was purchased from Synthego (guide sequence GCCAUAAUGGAGAAAUGAAC) along with the wild-type (WT) control and maintained in DMEM with 10% FBS.

Techniques: Expressing, Quantitation Assay, Comparison, Quantitative RT-PCR, Western Blot

Journal: Photochemistry and photobiology

Article Title: PLK4 is a Potential Therapeutic Target in Nonmelanoma Skin Cancers: Evidence from Molecular and in vivo Studies

doi: 10.1111/php.70006

Figure Lengend Snippet: Cell growth was determined using trypan blue exclusion assay comparing relative numbers of live (cells that do not uptake trypan blue dye when counting) A431 cSCC (a) and UW-BCC1 (b) cells remaining after treatment relative to control cells after 48 hours of treatment. Representative images and colony formation counts were used to assess clonogenic survival of A431 (c) and UW-BCC1 (d) cells 10–14 days post PLK4 inhibition. Data shown from at least two biological replicates performed in triplicate, and statistical significance is relative to DMSO-treated cells. (e) Following synchronization, A431 cells were treated with PLK4 inhibitors for 24 hours prior to propidium iodide (PI) staining and flow cytometry analysis. (f) UW-BCC1 cells were treated with indicated dose of inhibitors for 24 hours, stained with PI and analyzed for cell cycle distribution by flow cytometry. A431 (g) and UW-BCC1 (h) cells were treated for 48 hours with centrinone or CFI-400945 and then collected for staining with annexin V/PI for flow cytometry analysis of apoptosis. Data is presented as mean ± SEM with statistical significance *p ≤0.05; **p ≤0.01; *** p≤0.001; ****p<0.0001.

Article Snippet: A431 PLK4 knockout cell pool was purchased from Synthego (guide sequence GCCAUAAUGGAGAAAUGAAC) along with the wild-type (WT) control and maintained in DMEM with 10% FBS.

Techniques: Inhibition, Trypan Blue Exclusion Assay, Control, Staining, Flow Cytometry

Journal: Photochemistry and photobiology

Article Title: PLK4 is a Potential Therapeutic Target in Nonmelanoma Skin Cancers: Evidence from Molecular and in vivo Studies

doi: 10.1111/php.70006

Figure Lengend Snippet: Genes showing ≥2.0-fold regulation with statistical significance in the Human Cell Cycle PCR array from DMSO and 5 μM centrinone-treated A431 cSCC (a) and UW-BCC1 (b). The PCR array results were then subjected to Ingenuity Pathway Analysis (IPA). Top canonical pathways associated with the submitted genes were identified in centrinone-treated A431 cutaneous squamous cell carcinomas (cSCC) (c) and UW-BCC1 (e) cells. Orange colored bars indicate enhanced regulation (positive z-score), blue colored bars indicate inhibited regulation (negative z-score). IPA was further used to generate a gene network pathway associated with centrinone-modulated genes in A431 (d) and UW-BCC1 (f) cells. In these diagrams, interactions are indicated by arrows, solid lines denote robust correlation, and dashed lines indicate less frequent correlations. Green fill indicates downregulated and red fill indicates upregulated genes as found in the PCR array dataset. Blue lines and filled symbols indicate predicted inhibition and orange lines and filled symbols indicate predicted increases by IPA. Yellow lines indicate findings inconsistent with the state of downstream genes.

Article Snippet: A431 PLK4 knockout cell pool was purchased from Synthego (guide sequence GCCAUAAUGGAGAAAUGAAC) along with the wild-type (WT) control and maintained in DMEM with 10% FBS.

Techniques: Inhibition

Journal: Photochemistry and photobiology

Article Title: PLK4 is a Potential Therapeutic Target in Nonmelanoma Skin Cancers: Evidence from Molecular and in vivo Studies

doi: 10.1111/php.70006

Figure Lengend Snippet: NMSC cell lines were treated with PLK4 inhibitors 48 hours prior to fixing and probing with antibodies. DAPI (blue) in mountant medium was used to counterstain the nuclei of cells. (a) DMSO or PLK4 inhibitor-treated A431 cSCC cells were stained with anti-CEP 170 (yellow) to denote centrioles and anti-α-tubulin (orange) to distinguish microtubules and co-stain the centrosome during mitosis. (b) UW-BCC1 cells were stained with anti-CEP 152 (red), a centriolar protein, and anti-α-tubulin (green) to distinguish microtubules and co-stain the centrosome during mitosis. White arrows indicate abnormal cells with the occurrence of spindle formation, enlarged nuclei and centrosomes (CFI-400945 treated), star-like centrosome amplification and cells with depleted centrosomes (centrinone treated). Scale bar =100 nm.

Article Snippet: A431 PLK4 knockout cell pool was purchased from Synthego (guide sequence GCCAUAAUGGAGAAAUGAAC) along with the wild-type (WT) control and maintained in DMEM with 10% FBS.

Techniques: Immunofluorescence, Staining, Amplification

Journal: Photochemistry and photobiology

Article Title: PLK4 is a Potential Therapeutic Target in Nonmelanoma Skin Cancers: Evidence from Molecular and in vivo Studies

doi: 10.1111/php.70006

Figure Lengend Snippet: (a) Clones selected from a pool of CRISPR/Cas9-mediated PLK4 knockdown (KD) cells were tested for cell growth using the RealTime-Glo MT Cell Viability assay. (b) Representative images and colony counts are shown for clonogenic survival using a colony formation assay. (c) Genes with ≥2.0-fold regulation with statistical significance (p<0.05) as found via Cancer Pathway Finder PCR array. (d) The genes identified in response to PLK4 KD were subjected to Ingenuity Pathway Analysis (IPA). Top canonical pathways associated with the submitted genes were identified in A431 PLK4 KD cells. Orange bars indicate enhanced regulation (positive z-score), blue bars indicate inhibited regulation (negative z-score). (e) IPA was further used to generate gene network pathways associated with PLK4 KD in the A431 cells. In these diagrams, interactions are indicated by arrows, solid lines denote robust correlation, and dashed lines indicate less frequent correlations. Green fill indicates downregulated and red fill indicates upregulated genes as found in the PCR array dataset. Blue lines and filled symbols indicate predicted inhibition and orange lines and filled ones indicate predicted increases by IPA. Yellow lines indicate findings inconsistent with the state of downstream genes. Data shown are from duplicate experiments performed in triplicate and shown as mean ± SEM with statistical significance **p ≤0.01; **** p≤0.0001.

Article Snippet: A431 PLK4 knockout cell pool was purchased from Synthego (guide sequence GCCAUAAUGGAGAAAUGAAC) along with the wild-type (WT) control and maintained in DMEM with 10% FBS.

Techniques: Clone Assay, CRISPR, Knockdown, Viability Assay, Colony Assay, Inhibition

Journal: Photochemistry and photobiology

Article Title: PLK4 is a Potential Therapeutic Target in Nonmelanoma Skin Cancers: Evidence from Molecular and in vivo Studies

doi: 10.1111/php.70006

Figure Lengend Snippet: CRL:NU-Foxn1nu mice (n=7–8 per group) were implanted subcutaneously with 5 × 10 5 cells of either A431 WT or PLK4 knockdown (KD) cells mixed 1:1 with Matrigel. (a) Average tumor volumes as determined by Biopticon TumorImager for measurements at the indicated timepoints up to 28 days post-implantation is plotted. (b) At the end of the experiment, tumors were resected from the mice and weighed. (c) Representative images of excised tumors are shown. Scale bar = 1 cm. Data shown is mean ± SEM with statistical significance *** p ≤0.001; **** p ≤0.0001.

Article Snippet: A431 PLK4 knockout cell pool was purchased from Synthego (guide sequence GCCAUAAUGGAGAAAUGAAC) along with the wild-type (WT) control and maintained in DMEM with 10% FBS.

Techniques: Knockdown, In Vivo